1Department of Pathology, Seoul National University College of Medicine, Seoul, Korea
2Department of Neurosurgery, Seoul National University College of Medicine, Seoul, Korea
3Department of Radiology, Seoul National University College of Medicine, Seoul, Korea
4Department of Neurosicence Institute, Seoul National University College of Medicine, Seoul, Korea
© 2018 The Korean Society of Pathologists/The Korean Society for Cytopathology
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
OA, oligoastrocytoma; AOA, anaplastic oligoastrocytoma; GBMO, glioblastoma with oligodendroglioma component; OS, overall survival; PFS, progression-free survival; F, frontal lobe; T, temporal lobe; P, parietal lobe; HIPP, hippocampus; O, occipital lobe; TH, thalamus; CC, corpus callosum; PO, parieto-occipital; FTI, frontotemporoinsular area; FTP, frontotemporoparietal lobe; CCRT, concurrent chemoradiotherapy.
Primer | Sequence (5’ → 3’) |
---|---|
IDH 1-F | ACCAAATGGCACCATACGA |
IDH 1-R | GCAAAATCACATTATTGCCAAC |
IDH 2-F | GCTGCAGTGGGACCACTATT |
IDH 2-R | TGTGGCCTTGTACTGCAGAG |
DA, diffuse astrocytoma; m, mutant; w, wildtype; AA, anaplastic astrocytoma; AO, anaplastic oligodendroglioma; GBM, glioblastoma; OS, overall survival; PFS, progression-free survival; F, frontal lobe; T, temporal lobe; P, parietal lobe; O, occipital lobe; TH, thalamus; HIPP, hippocampus; FTI, frontotemporoinsular area; FTP, frontotemproparietal lobe; CC, corpus callosum; PO, parieto-occipital; CCRT, concurrent chemoradiotherapy.
Parameter | OA (n = 15) | AOA (n = 14) | GBMO (n = 29) |
---|---|---|---|
Age (yr) | |||
Mean (range) | 40.8 (14–72) | 41.1 (13–64) | 53.5 (31–77) |
Median | 36 | 35.5 | 56 |
Sex (male:female) | 11:4 | 5:9 | 22:7 |
Median OS (mo) | 45.3 | 21.7 | 26.7 |
Median PFS (mo) | 39.8 | 20.9 | 19.0 |
Tumor location | F8 T4 P1 PT1 HIPP1 | F6 T5 P1 O1 TH1 | F13 T10 P1 TH1 CC1 PO1 FTI1 FTP1 |
Treatment | Surgery only | Surgery only 13 | CCRT 21 |
Others 1 | Others 8 |
Primer | Sequence (5’ → 3’) |
---|---|
IDH 1-F | ACCAAATGGCACCATACGA |
IDH 1-R | GCAAAATCACATTATTGCCAAC |
IDH 2-F | GCTGCAGTGGGACCACTATT |
IDH 2-R | TGTGGCCTTGTACTGCAGAG |
Original diagnosis (n = 58) | Re-diagnosis (n = 58) |
|
---|---|---|
Criteria | No. (%) | |
OA, grade II (n = 14) | DA IDH-m | 2 (14.3) |
DA IDH-w | 2 (14.3) | |
AA IDH-m | 7 (50) | |
AA IDH-w | 2 (14.3) | |
AO IDH-m and 1p/19q-codeleted | 1 (7.1) | |
AOA, grade III (n = 14) | AA IDH-m | 6 (42.9) |
AA IDH-w | 5 (35.7) | |
AO IDH-m and 1p/19q-codeleted | 3 (17.6) | |
GBMO, grade IV (n = 29) | GBM IDH-w | 16 (55.2) |
GBM IDH-m | 11 (37.9) | |
AO IDH-m and 1p/19q-codeleted | 2 (6.9) |
Parameter | DA IDH-m (n = 2) | DA IDH-w (n = 2) | AA IDH-m (n = 13) | AA IDH-w (n = 8) | AO (n = 6) | GBM IDH-m (n = 11) | GBM IDH-w (n = 16) |
---|---|---|---|---|---|---|---|
Age, mean (range, yr) | 37.5 (31–44) | 49.5 (32–67) | 39.3 | 39.9 (14–64) | 52.6 (35–69) | 42.3 (34–58) | 58.4 (31–77) |
Sex (male:female) | 2:0 | 1:1 | 9:4 | 3:5 | 3:3 | 7:4 | 13:3 |
ATRX (–), n (%) | 2 (100) | 1 (50) | 12 (92.3) | 7 (87.5) | 0 | 7 (63.6) | 5 (31.3) |
1p/19q codel | 0 | 0 | 0 | 0 | 6 | 0 | 0 |
Primary GBM | 7 | 14 | |||||
Secondary GBM | 4 | 1 | |||||
OS (mo) | 36.5 | 19.5 | 29.8 | 34.5 | 45.5 | 43.6 | 14.5 |
PFS (mo) | 36.0 | 18.9 | 29.0 | 27.3 | 34.0 | 33.4 | 9.1 |
Tumor location | F1 P1 | F2 | F5 T6 P1 PT1 | F4 T1 O1 TH1 HIPP1 | F4 T2 | F6 T3 FTI1 FTP1 | F5 T7 P1 CC1 PO1 TH1 |
Treatment | Surgery only | Surgery only | Surgery only | Surgery only 7 | Surgery only 4 | CCRT 10 | CCRT 11 |
Others 1 | CCRT 1 | Others 1 | Others 5 | ||||
Others 1 |
OA, oligoastrocytoma; AOA, anaplastic oligoastrocytoma; GBMO, glioblastoma with oligodendroglioma component; OS, overall survival; PFS, progression-free survival; F, frontal lobe; T, temporal lobe; P, parietal lobe; HIPP, hippocampus; O, occipital lobe; TH, thalamus; CC, corpus callosum; PO, parieto-occipital; FTI, frontotemporoinsular area; FTP, frontotemporoparietal lobe; CCRT, concurrent chemoradiotherapy.
F, forward; R, reverse.
OA, oligoastrocytoma; AOA, anaplastic oligoastrocytoma; GBMO, glioblastoma with oligodendroglioma component; DA, diffuse astrocytoma; IDH-m, IDH-mutant; IDH-w, IDH-wildtype; AA, anaplastic astrocytoma; AO, anaplastic oligodendroglioma; GBM, glioblastoma.
DA, diffuse astrocytoma; m, mutant; w, wildtype; AA, anaplastic astrocytoma; AO, anaplastic oligodendroglioma; GBM, glioblastoma; OS, overall survival; PFS, progression-free survival; F, frontal lobe; T, temporal lobe; P, parietal lobe; O, occipital lobe; TH, thalamus; HIPP, hippocampus; FTI, frontotemporoinsular area; FTP, frontotemproparietal lobe; CC, corpus callosum; PO, parieto-occipital; CCRT, concurrent chemoradiotherapy.