Skip Navigation
Skip to contents

J Pathol Transl Med : Journal of Pathology and Translational Medicine

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > J Pathol Transl Med > Volume 53(4); 2019 > Article
Original Article
Prognostic Significance of CD109 Expression in Patients with Ovarian Epithelial Cancer
So Young Kimorcid, Kyung Un Choi1orcid, Chungsu Hwangorcid, Hyung Jung Leeorcid, Jung Hee Leeorcid, Dong Hoon Shinorcid, Jee Yeon Kimorcid, Mee Young Solorcid, Jae Ho Kim2orcid, Ki Hyung Kim3orcid, Dong Soo Suh3orcid, Byung Su Kwon3orcid
Journal of Pathology and Translational Medicine 2019;53(4):244-252.
DOI: https://doi.org/10.4132/jptm.2019.04.16
Published online: May 2, 2019

Department of Pathology, Pusan National University Yangsan Hospital, Yangsan, Korea

1Department of Pathology, Pusan National University Hospital, Busan, Korea

2Department of Physiology, Pusan National University School of Medicine, Busan, Korea

3Department of Obstetrics and Gynecology, Pusan National University Hospital, Busan, Korea

Corresponding Author Kyung Un Choi, MD, PhD Department of Pathology, Pusan National University Hospital, Busan National University School of Medicine, 179 Gudeok-ro, Seo-gu, Busan 49241, Korea Tel: +82-51-510-8055 Fax: +82-51-510-8140 E-mail: kuchoi@pusan.ac.kr
• Received: December 26, 2018   • Revised: March 17, 2019   • Accepted: April 16, 2019

© 2019 The Korean Society of Pathologists/The Korean Society for Cytopathology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

prev next
  • 9,450 Views
  • 130 Download
  • 9 Web of Science
  • 7 Crossref
  • 9 Scopus
  • Background
    Ovarian epithelial cancer (OEC) is the second-most common gynecologic malignancy. CD109 expression is elevated in human tumor cell lines and carcinomas. A previous study showed that CD109 expression is elevated in human tumor cell lines and CD109 plays a role in cancer progression. Therefore, this study aimed to determine whether CD109 is expressed in OEC and can be useful in predicting the prognosis.
  • Methods
    Immunohistochemical staining for CD109 and reverse transcription-quantitative polymerase chain reaction was performed. Then we compared CD109 expression and chemoresistance, overall survival, and recurrence-free survival of OEC patients. Chemoresistance was evaluated by dividing into good-response group and poor-response group by the time to recurrence after chemotherapy.
  • Results
    CD109 expression was associated with overall survival (p = .020), but not recurrence-free survival (p = .290). CD109 expression was not an independent risk factor for overall survival due to its reliability (hazard ratio, 1.58; p = .160; 95% confidence interval, 0.82 to 3.05), although we found that CD109 positivity was related to chemoresistance. The poor-response group showed higher rates of CD109 expression than the good-response group (93.8% vs 66.7%, p = .047). Also, the CD109 mRNA expression level was 2.88 times higher in the poor-response group as compared to the good-response group (p = .001).
  • Conclusions
    Examining the CD109 expression in patients with OEC may be helpful in predicting survival and chemotherapeutic effect.
Ovarian epithelial cancer (OEC) is the second most common gynecologic malignancy [1]. However, it is often found in advanced stages, which makes it difficult to treat. OEC is believed to have an insidious onset, with no early symptoms [2]. Survival rates for women with advanced disease range from 20%–30%, which are much lower than those for women with early stage disease (70%–90%) [3]. Despite tumor-debulking surgery and chemotherapy, the 50-year survival rate is as low as 40% [4]. Although factors associated with the prognosis of OEC, such as p53 and human epidermal growth factor receptor 2 expression, have been reported [5,6], only a few factors can predict poor outcome in patients with OEC.
CD109 is a glycosylphosphatidylinositol-linked cell surface glycoprotein and a member of the 2-macroglobulin-C3, C4, C5 family of thioester-containing proteins [7]. CD109 expression is limited in certain cell types in normal tissues, including myoepithelial cells of the breast, salivary gland, and basal cells of the prostate [8]. CD109 protein is a component of the transforming growth factor β1 (TGF-β1) receptor system, which is involved in cell proliferation and differentiation and has both tumor-suppressive and promoting effects during carcinogenesis [9]. However, its functions are still unknown. A previous study showed that CD109 expression is elevated in human tumor cell lines and CD109 plays a role in cancer progression [10]. CD109 expression is significantly increased in carcinomas of the lung, gallbladder, uterine cervix, and vulva and soft tissue sarcomas [10-14]. In addition, CD109 expression in lung squamous cell carcinoma is associated with the tumor stage, and its expression in myxofibrosarcomas is useful to predict recurrence [11,15]. Thus, CD109 could be expressed in OEC and may be a useful predictor of OEC prognosis.
The aim of this study was to evaluate CD109 expression by immunohistochemistry and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) using clinical specimens of human OEC; to analyze the correlation between CD109 expression and survival rate, recurrence rate, and chemotherapy response in patients with OEC; and to investigate the prognostic significance of CD109 expression.
Patients and data
OEC patients who underwent surgical resection at Pusan National University Hospital from 1998 to 2009 were selected for this study. All patients provided written informed consents and underwent surgical procedures. The biospecimens and data used for this study were provided by the Biobank of Pusan National University Hospital (PNUH), a member of the Korea Biobank Network. All samples derived from the National Biobank of Korea were obtained with the approval of institutional review board. After exclusion of cases with insufficient tissue material and clinical information, a total of 120 cases were enrolled and representative formalin-fixed paraffin tissue blocks were collected. Pathological data including histological type, pathological stage, tumor histological grade, nuclear grade, and mitosis were obtained from the primary pathology report. The histological tumor type was classified according to the World Health Organization criteria [16]. Histological grades were classified as well-, moderately, and poorly differentiated according to the Silverberg grading system [17]. The tumors were staged according to the International Federation of Gynecology and Obstetrics (FIGO) staging system (Table 1) [18].
Fresh tissue samples of OEC were obtained by surgical resection and stored in the Biobank of PNUH. For this study, tissue samples from 12 patients who underwent resection were examined. We evaluated 12 patients with serous carcinoma who received chemotherapy. Six patients who did not experience relapse for 18 months after chemotherapy were included in the good-response group, and six patients who experienced recurrence within 6 months of chemotherapy initiation to 8 months of chemotherapy completion were included in the poor-response group (Table 2).
Immunohistochemistry
CD109 expression was assessed using CD109 immunohistochemical staining. The slides were then dewaxed in xylene and dehydrated in ethanol. Staining was performed using BondMax-autostainer and other reagents (Leica Microsystems, Berlin, Germany). Deparaffinization was performed automatically in the autostainer with BondWash solution (Leica Microsystems) at 72°C for 30 minutes. After washing, the slides were incubated overnight at 4°C with a rabbit polyclonal anti-CD109 antibody (dilution 1:50, cat. No., HPA009292, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) and incubated with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (dilution 1:100, cat. No., SA00001-2, ProteinTech Group, Inc., Wuhan Sanying Biotechnology, Wuhan, China) for 90 minutes at room temperature. Antibody binding was performed by incubating the slides for 1 minute with a solution of 1 drop of 3,3'-diamino-benzidine (20 ×) per 1.0 mL diamino-benzidine substrate buffer (cat. No. ZLI-9017, Origene Technologies, Inc., Beijing, China). The slides were then counterstained with EnVision FLEX hematoxylin (Dako, Agilent Technologies, Inc., Santa Clara, CA, USA) for 1 minute and dehydrated using ethanol and xylene. For negative control, staining was performed without primary antibody.
Assessment of immunohistochemical staining
Slides were evaluated using light microscopy. CD109 expression was detected through cytoplasmic and/or membranous staining of the tumor cells. The CD109 positivity of tumor cells was determined as follows: positive staining, ≥ 10% positive tumor cells and negative staining, < 10% positive tumor cells.
RT-qPCR
The mRNA levels of CD109 in the fresh tissue samples of OEC were measured using RT-qPCR. Total RNA was purified from cells using RNeasy mini prep kits (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 μg RNA using the ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). Differential RNA levels were assessed using Luna Universal qPCR Master Mix (New England Biolabs) and primers for each gene. Quantitative PCR reactions were performed using an ECO Real-Time PCR system (PCRmax, Straffordshire, UK) as follows: 95°C for 30 minutes followed by 40 cycles at 95°C for 10 seconds, 61°C for 30 seconds, and 72°C for 20 seconds. The PCR products were analyzed using ECO ware (PCRmax). All samples were normalized to the signal generated from glyceraldehyde 3-phosphate dehydrogenase using the primers presented in Table 3. The CD109 gene expression was generalized by comparing the relative expression of CD109 with the internal standard glyceraldehyde 3-phosphate dehydrogenase using the 2-ΔΔCT method [19].
Statistical analysis
The Pearson’s chi-square test was used to assess statistical significance between CD109 expression and various clinicopathological characteristics. Overall survival and recurrence-free survival were estimated using Kaplan-Meier plots. Multivariate analyses to determine hazard ratios for overall survival and recurrence-free survival were performed using Cox regression analysis. All analyses were performed using SPSS software (IBM, Armonk, NY, USA). A p-value of < 0.05 was considered statistically significant.
Patient characteristics
A series of 120 OEC cases was retrieved for this study. The follow-up period ranged from 1 to 115 months (median, 50 months), and the patient age ranged from 15 to 82 years (median, 50 years). There were 59 cases of serous carcinoma, 22 cases of mucinous carcinoma, nine cases of endometrioid carcinoma, 27 cases of clear cell carcinoma, and three cases of undifferentiated carcinoma. The overall survival rate was 52.5%, and the recurrence rate was 77.5%. Other clinicopathologic parameters are presented in Table 1.
CD109 expression in OEC
In OEC samples, the malignant tumor cells exhibited brownish CD109 staining in the membrane and cytoplasm (Fig. 1). CD109 expression was detected in 63 of the 120 OEC samples (52.5%). CD109 expression differed according to the histological type of tumor (p < .001). There was a statistically significantly increase in the expression of CD109 in serous, endometrioid, and undifferentiated carcinomas (77.4%). CD109 expression was associated with a higher histological tumor grade (p = .012). Twelve of 51 FIGO stage I tumors (23.5%) and 51 of 69 FIGO stage II, III, and IV tumors (73.9%) were positive for CD109 (p < .001). Thirteen of 45 tumors with < 10 mitotic events (28.9%) and 50 of 75 tumors with more than 10 mitotic events (66.7%) were positive for CD109 (p < .001). A high nuclear grade was not associated with CD109 expression (Table 4).
In the above results, CD109 positivity ratio varied according to the histologic type, and the following is the CD109 expression results in serous carcinoma that accounts for the largest percentage of OEC: Six of 13 FIGO stage I tumors (46.2%) and 40 of 46 FIGO stage II, III, and IV tumors (87.0%) were positive for CD109 (p = .004). Histologic grade, high nuclear grade, and high mitotic counts were not associated with CD109 expression (Table 5).
Association between CD109 expression and OEC prognosis
CD109 expression was associated with overall survival (p = .020) (Fig. 2), but not recurrence-free survival (p = .290) (Fig. 3). The 5-year survival rate was 42.5% in patients with CD109-positive results and 64.8% in patients with CD109-negative results (p = .020) (Fig. 2). Analysis of the variables using multivariate analysis showed that CD109 expression was not an independent risk factor for overall survival due to its low reliability (hazard ratio [HR], 1.58; p = .160; 95% confidence interval [CI], 0.82 to 3.05) (Table 6). In addition, CD109 expression was not an only risk factor for recurrence-free survival (HR, 2.06; p = .110; 95% CI, 0.83 to 5.09) (Table 7). Therefore, CD109 expression is not an independent prognostic factor but is helpful for predicting the prognosis of patients with OEC.
Immunohistochemical staining was performed in 37 patients with serous carcinoma who received chemotherapy, 21 patients belonged to the good-response group and 16 patients belonged to the poor-response group. The poor-response group had higher rates of CD109 expression than the good-response group (93.8% vs 66.7%, p = .047) (Table 8). Thus, CD109 is useful for predicting the chemotherapeutic effect in patients with OEC, especially serous carcinoma.
CD109 mRNA levels in OECs
All 12 fresh OEC samples were examined for CD109 expression by RT-qPCR. The samples were limited to serous carcinoma of OEC. CD109 mRNA was significantly upregulated in the poor-response group compared with the good-response group (p = .001) (Fig. 4), suggesting that high CD109 expression level is associated with chemoresistance in patients with OEC.
The physiological function of CD109 has not been studied, yet it is highly expressed in various types of malignancies and several normal tissues [8,20]. It has recently been reported that CD109 expression is associated with tumor development and cell proliferation using human oral tumor tissues and cancer cell lines [21]. In addition, CD109 can predict prognosis in tumors such as myxofibrosarcoma [15]. In this study, we evaluated CD109 expression in OEC samples by immunohistochemical stains and RT-qPCR and found that an increased CD109 expression was associated with the prognosis and chemoresistance of OEC.
CD109 protein is a component of the TGF-β1 receptor system [9]. Tumor suppression occurs through the TGF-β1–signaling pathway in the early tumor stage; however, in malignantly transformed cells, TGF-β1 is severely dysregulated, resulting in the loss of tumor suppression [9]. CD109 expression is followed by a complex formation with the type I TGF-β1 receptor, which is required for the regulation of TGF-β1 signaling in early tumor cells [22]. Finally, CD109 degrades the TGF-β1 receptor and blocks TGF-β1 signaling, thereby preventing tumor suppression [23], which was confirmed in a mouse model [24]. In CD109-deficient mice, the TGF-β1 signaling pathway was enhanced and it suppressed skin tumorigenesis [24].
TGF-β1 plays an important role in chemoresistance in breast cancer and squamous cell carcinoma [25,26]. During TGF-β1 expression, cancer cells proliferate slowly in early tumor stage and lead to chemoresistance because they can be protected against DNA-damaging chemotherapeutic agents [26]. In myxofibrosarcomas, tumors with high CD109 expression level showed decreased expression of TGF-β1 with a good treatment effect [27]. However, tumors with low CD109 expression and high TGF-β1 expression showed chemoresistance [27]. The current case and the other cases mentioned above indicate that there are other underlying mechanisms stronger than the CD109–TGF-β1 signaling pathway. In our study, the relationship between CD109 expression and chemoresistance was identified, but TGF-β1 expression and its role were not confirmed. If both CD109 and TGF-β1 are found to be related to the chemoresistance of OEC, it will be helpful in treating patients. Therefore, further research is needed to confirm these findings in OEC.
CD109 expression has been associated with chemotherapeutic resistance in triple-negative breast cancers [28]. After chemotherapy was administered to patients with CD109-positive triple negative breast cancer, 50% of the patients showed disease progression and none of them showed complete response [28]. The same result was reported when examining the CD109 expression and chemotherapeutic effect in breast cancer and glioblastoma [29,30]. This may be due to the role of CD109 in the development of endothelial cells and induction of angiogenesis in contrary to the effect of chemotherapy regimen, which blocks tumor neovascularization [30]. In this study, CD109 was expressed at a higher rate in the poor-response group than in the good-response group. In addition, the expression level of CD109 mRNA was 2.88-fold higher in the poor-response group than in the good-response group. However, unlike breast cancer, most OECs are diagnosed at advanced stages, making it difficult to divide the chemotherapy response group into more detailed subgroups.
CD109 is involved in the pathogenesis and prognosis of some tumors. CD109 overexpression is known to induce cell growth in oral squamous cell carcinomas, and CD109-positive oral dysplastic lesions develop into squamous cell carcinoma within 3 years [21]. Although there is no correlation between the CD109 expression and mitosis, CD109 expression was associated with neoplastic cell growth [31]. Recently, a study suggested that CD109 expression is managed by cancer stem-like cells/cancer-initiating cells, which can initiate tumorigenesis and tumor growth in sarcomas [14]. Therefore, in the presence of cancer stem cells, CD109 expression may increase and malignancies or recurrence/metastasis may develop. In our study, CD109 expression was higher in the advanced stage, but OEC precursors such as borderline ovarian tumor is not included in the study. More research that can determine the association of CD109 with neoplastic cell growth in ovary tissue may be helpful in early detection and treatment of patients.
Based on our review, this is the first study on the relationship between CD109 expression and prognosis of OEC. The present study demonstrated that CD109 is highly expressed in OEC tissues. Immunohistochemical analysis of CD109 expression is useful for predicting overall survival but not recurrence-free survival. Regarding the chemotherapeutic effect on serous carcinoma, the poor-response group expressed increased mRNA levels of CD109 as compared to the good-response group. Therefore, identification of CD109 expression may help in predicting the survival and chemotherapeutic effect in patients with serous carcinoma of OEC. Further analysis of other factors related to CD109 is needed for careful management of patients with serous carcinoma of OEC.
This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (NRF-2017R1A2B4009021) and the Korea Health Technology R&D Project, Ministry of Health and Welfare (HI17C1635). The biospecimens for this study were provided by the Biobank of Pusan National University Hospital, a member of the National Biobank of Korea, which is supported by the Ministry of Health, Welfare and Family Affair.
Fig. 1.
Immunohistochemical staining of CD109 in ovarian epithelial carcinoma. (A) Positive in serous carcinoma. (B) Positive in mucinous carcinoma. (C) Positive in endometrioid carcinoma. (D) Positive in clear cell carcinoma. (E) Positive in undifferentiated carcinoma. (F) Negative in serous carcinoma.
jptm-2019-04-16f1.jpg
Fig. 2.
Expression of CD109 protein is associated with overall survival. Prognosis is estimated by Kaplan-Meier plots (p=.020).
jptm-2019-04-16f2.jpg
Fig. 3.
Expression of CD109 protein is not significantly associated with recurrence. Prognosis is estimated by Kaplan-Meier plots (p=.290).
jptm-2019-04-16f3.jpg
Fig. 4.
Relationship between chemoresistance and CD109 mRNA expression (n=12).
jptm-2019-04-16f4.jpg
Table 1.
Characteristic of the patients
No. (%) (n = 120)
Follow-up, median (range, mo) 50 (1–115)
Age at diagnosis (yr) 51 (15–82)
 < 50 57 (47.5)
 ≥ 50 63 (52.5)
Histologic type
 Serous 59 (49.2)
 Mucinous 22 (18.3)
 Endometrioid 9 (7.5)
 Clear cell 27 (22.5)
 Undifferentiated 3 (2.5)
Histologic grade
 Well differentiated 28 (23.3)
 Moderate differentiated 61 (50.8)
 Poorly differentiated 31 (25.8)
Nuclear grade
 I 6 (5.0)
 II 65 (54.2)
 III 49 (40.8)
FIGO stage
 I 51 (42.5)
 II 6 (5)
 III 44 (36.7)
 IV 19 (15.8)
Mitosis (per 10HPFs)
 1–9 45 (37.5)
 10–19 41 (34.2)
 ≥ 20 34 (28.3)
Overall survival
 Survival 63 (52.5)
 Death 57 (47.5)
Recurrence
 Absent 27 (22.5)
 Present 93 (77.5)

FIGO, International Federation of Gynecology and Obstetrics; HPF, high-power field.

Table 2.
Fresh tissue samples of ovarian epithelial carcinoma
Case No. Histologic type Stage Chemotherapy regimen Period before recurrence (mo) Response
1 Serous IIIc Carbo-Taxola 4 Poor response
2 Serous IV Carbo-Taxol 8 Poor response
3 Serous IIIc Carbo-Taxol 4 Poor response
4 Serous IIIc Carbo-Taxol 0 Poor response
5 Serous IV Carbo-Taxol 1 Poor response
6 Serous IV Carbo-Taxol 0 Poor response
7 Serous IIIc Carbo-Taxol No recur Good response
8 Serous IIIc Carbo-Taxol No recur Good response
9 Serous IIIc Carbo-Taxol No recur Good response
10 Serous IIa Carbo-Taxol 38 Good response
11 Serous IIIc Carbo-Taxol No recur Good response
12 Serous IV Carbo-Taxol 25 Good response

aPacilitaxel and carboplatin.

Table 3.
Primer sequences
Gene Sequence (5'-3')
Cluster of differentiation 109
 Forward GAAGCCATCTCTCAACTTCACA
 Reverse CTCCTTGGAGGCCATGTG
GAPDH
 Forward GAAGGTGGTGAAGCAGGC
 Reverse TTCCACTGTTAGATCCGCTCC

GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Table 4.
Correlation between CD109 expression and clinicopathological characteristics in ovarian epithelial carcinomas (n = 120)
Parameter Negative Positive p-valuea
Histologic type .000
 Serous 13 (22.0) 46 (78.0)
 Mucinous 19 (86.4) 3 (13.6)
 Endometrioid 3 (33.3) 6 (66.7)
 Clear cell 22 (81.5) 5 (18.5)
 Undifferentiated 0 (0) 3 (100)
Histologic grade .012
 Well differentiated 19 (67.9) 9 (32.1)
 Moderate differentiated 29 (47.5) 32 (52.5)
 Poorly differentiated 9 (29.0) 22 (71.0)
Nuclear grade .788
 I 3 (50.0) 3 (50.0)
 II 29 (44.6) 36 (55.4)
 III 25 (51.0) 24 (49.0)
FIGO stage .000
 I 39 (76.5) 12 (23.5)
 II, III and IV 18 (26.1) 51 (73.9)
Mitoses (per 10HPFs) .000
 1–9 32 (71.1) 13 (28.9)
 ≥ 10 25 (33.3) 50 (66.7)

Negative, less than 10% positive staining of tumor cells; Positive, more than 10% positive staining of tumor cells.

FIGO, Federation of Gynecology and Obstetrics; HPF, high power field.

aPearson’s chi-squared test.

Table 5.
Correlation between CD109 expression and clinicopathological characteristics in serous carcinoma (n = 59)
Parameter Negative Positive p-valuea
Histologic grade .351
 Well differentiated 2 (40.0) 3 (60.0)
 Moderate differentiated 9 (24.3) 28 (75.7)
 Poorly differentiated 2 (11.8) 15 (88.2)
Nuclear grade .850
 I 0 (0) 1 (100)
 II 8 (21.6) 29 (78.4)
 III 5 (23.8) 16 (76.2)
FIGO stage .004
 I 7 (53.8) 6 (46.2)
 II, III and IV 6 (13.0) 40 (87.0)
Mitoses (per 10HPFs) .959
 1–9 3 (25.0) 9 (75.0)
 10–19 5 (21.7) 18 (78.3)
 ≥ 20 5 (20.8) 19 (79.2)

Values are presented as number (%).

FIGO, Federation of Gynecology and Obstetrics; HPF, high power field; Negative, less than 10% positive staining of tumor cells; Positive, more than 10% positive staining of tumor cells.

aPearson’s chi-squared test.

Table 6.
Multivariate analysis of overall survival (n = 120)
Variable Hazard ratio 95% confidence interval p-value
Histologic grade
 Well differentiated 1
 Moderate differentiated 0.33 0.12–0.87 .020
 Poorly differentiated 0.63 0.34–1.14 .130
FIGO stage
 I 1
 II, III, and IV 0.17 0.07–0.38 < .001
CD109 expression
 Negative 0
 Positive 1.58 0.82–3.05 .160
Table 7.
Multivariate analysis of recurrence-free survival (n = 120)
Variable Hazard ratio 95% confidence interval p-value
Histologic grade
 Well differentiated 1
 Moderate differentiated 0.34 0.09–1.26 .220
 Poorly differentiated 0.53 0.21–1.32 .100
FIGO stage
 I 1
 II, III, and IV 1.29 0.41–0.41 < .001
CD109 expression
 Negative 1
 Positive 2.06 0.83–5.09 .110
Table 8.
Chemotherapy response in correlation with CD109 expression
Parameter CD109 expression
Negative Positive
Good response group 7 (33.3) 14 (66.7)
Poor response group 1 (12.5) 15 (93.8)

Values are presented as number (%).

  • 1. Montes AF, Gomez JG, Viejo MN, Bermejo MA, Urrutia SA, Mata JG. Epidemiology and etiology of ovarian cancer. In: Farghaly S, ed. Ovarian cancer: basic science perspective. Vancouver: InTech, 2012; 1-16.
  • 2. Flam F, Einhorn N, Sjövall K. Symptomatology of ovarian cancer. Eur J Obstet Gynecol Reprod Biol 1988; 27: 53-7. ArticlePubMed
  • 3. Goff BA, Mandel L, Muntz HG, Melancon CH. Ovarian carcinoma diagnosis. Cancer 2000; 89: 2068-75. ArticlePubMed
  • 4. Liu J, Matulonis UA. New strategies in ovarian cancer: translating the molecular complexity of ovarian cancer into treatment advances. Clin Cancer Res 2014; 20: 5150-6. ArticlePubMedPDF
  • 5. Hartmann LC, Podratz KC, Keeney GL, et al. Prognostic significance of p53 immunostaining in epithelial ovarian cancer. J Clin Oncol 1994; 12: 64-9. ArticlePubMed
  • 6. Luo H, Xu X, Ye M, Sheng B, Zhu X. The prognostic value of HER2 in ovarian cancer: a meta-analysis of observational studies. PLoS One 2018; 13: e0191972. ArticlePubMedPMC
  • 7. Lin M, Sutherland DR, Horsfall W, et al. Cell surface antigen CD109 is a novel member of the alpha(2) macroglobulin/C3, C4, C5 family of thioester-containing proteins. Blood 2002; 99: 1683-91. PubMedPDF
  • 8. Hasegawa M, Hagiwara S, Sato T, et al. CD109, a new marker for myoepithelial cells of mammary, salivary, and lacrimal glands and prostate basal cells. Pathol Int 2007; 57: 245-50. ArticlePubMed
  • 9. Leivonen SK, Kähäri VM. Transforming growth factor-beta signaling in cancer invasion and metastasis. Int J Cancer 2007; 121: 2119-24. PubMed
  • 10. Zhang JM, Hashimoto M, Kawai K, et al. CD109 expression in squamous cell carcinoma of the uterine cervix. Pathol Int 2005; 55: 165-9. ArticlePubMed
  • 11. Sato T, Murakumo Y, Hagiwara S, et al. High-level expression of CD109 is frequently detected in lung squamous cell carcinomas. Pathol Int 2007; 57: 719-24. ArticlePubMed
  • 12. Dong F, Lu C, Chen X, Guo Y, Liu J. CD109 is a novel marker for squamous cell/adenosquamous carcinomas of the gallbladder. Diagn Pathol 2015; 10: 137.ArticlePubMedPMCPDF
  • 13. Ozbay PÖ, Ekinci T, Yigˇit S, et al. Investigation of prognostic significance of CD109 expression in women with vulvar squamous cell carcinoma. Onco Targets Ther 2013; 6: 621-7. PubMedPMC
  • 14. Emori M, Tsukahara T, Murase M, et al. High expression of CD109 antigen regulates the phenotype of cancer stem-like cells/cancerinitiating cells in the novel epithelioid sarcoma cell line ESX and is related to poor prognosis of soft tissue sarcoma. PLoS One 2013; 8: e84187. ArticlePubMedPMC
  • 15. Emori M, Tsukahara T, Murata K, et al. Prognostic impact of CD109 expression in myxofibrosarcoma. J Surg Oncol 2015; 111: 975-9. ArticlePubMed
  • 16. Kurman RJ, Carcangiu ML, Herrington CS, Young RH. WHO classification of tumours of female reproductive organs. 4th ed. Lyon: International Agency for Research on Cancer, 2014; 11-40.
  • 17. Shimizu Y, Kamoi S, Amada S, Akiyama F, Silverberg SG. Toward the development of a universal grading system for ovarian epithelial carcinoma: testing of a proposed system in a series of 461 patients with uniform treatment and follow-up. Cancer 1998; 82: 893-901. ArticlePubMed
  • 18. Pecorelli S, Benedet JL, Creasman WT, Shepherd JH. FIGO staging of gynecologic cancer. 1994-1997 FIGO Committee on Gynecologic Oncology. International Federation of Gynecology and Obstetrics. Int J Gynaecol Obstet 1999; 65: 243-9. PubMed
  • 19. Yuan JS, Reed A, Chen F, Stewart CN Jr. Statistical analysis of realtime PCR data. BMC Bioinformatics 2006; 7: 85.ArticlePubMedPMCPDF
  • 20. Hashimoto M, Ichihara M, Watanabe T, et al. Expression of CD109 in human cancer. Oncogene 2004; 23: 3716-20. ArticlePubMedPDF
  • 21. Hagiwara S, Murakumo Y, Sato T, et al. Up-regulation of CD109 expression is associated with carcinogenesis of the squamous epithelium of the oral cavity. Cancer Sci 2008; 99: 1916-23. ArticlePubMedPMC
  • 22. Hagiwara S, Murakumo Y, Mii S, et al. Processing of CD109 by furin and its role in the regulation of TGF-beta signaling. Oncogene 2010; 29: 2181-91. ArticlePubMedPDF
  • 23. Cuppini L, Calleri A, Bruzzone MG, et al. Prognostic value of CD109+ circulating endothelial cells in recurrent glioblastomas treated with bevacizumab and irinotecan. PLoS One 2013; 8: e74345. ArticlePubMedPMC
  • 24. Hasegawa M, Moritani S, Murakumo Y, et al. CD109 expression in basal-like breast carcinoma. Pathol Int 2008; 58: 288-94. ArticlePubMed
  • 25. Tao J, Li H, Li Q, Yang Y. CD109 is a potential target for triple-negative breast cancer. Tumour Biol 2014; 35: 12083-90. ArticlePubMedPDF
  • 26. Mancuso P, Calleri A, Gregato G, et al. A subpopulation of circulating endothelial cells express CD109 and is enriched in the blood of cancer patients. PLoS One 2014; 9: e114713. ArticlePubMedPMC
  • 27. Tsai YL, Ha DP, Zhao H, et al. Endoplasmic reticulum stress activates SRC, relocating chaperones to the cell surface where GRP78/CD109 blocks TGF-beta signaling. Proc Natl Acad Sci U S A 2018; 115: E4245-54. PubMedPMC
  • 28. Sunagawa M, Mii S, Enomoto A, et al. Suppression of skin tumorigenesis in CD109-deficient mice. Oncotarget 2016; 7: 82836-50. ArticlePubMedPMC
  • 29. Bhola NE, Balko JM, Dugger TC, et al. TGF-beta inhibition enhances chemotherapy action against triple-negative breast cancer. J Clin Invest 2013; 123: 1348-58. ArticlePubMedPMC
  • 30. Oshimori N, Oristian D, Fuchs E. TGF-beta promotes heterogeneity and drug resistance in squamous cell carcinoma. Cell 2015; 160: 963-76. ArticlePubMedPMC
  • 31. De Vita A, Recine F, Mercatali L, et al. Myxofibrosarcoma primary cultures: molecular and pharmacological profile. Ther Adv Med Oncol 2017; 9: 755-67. ArticlePubMedPMCPDF

Figure & Data

References

    Citations

    Citations to this article as recorded by  
    • CD109 Expression in Tumor and Stromal Cells Serves as a Prognostic Biomarker for Tumor Progression and Outcome in Gallbladder Adenocarcinoma
      Taro Kogami, Masaaki Ichinoe, Yasutaka Sakurai, Takuya Kato, Masahiro Matsushita, Akihiro Tamaki, Yurika Kesen, Shoko Hayashi, Itaru Sanoyama, Yoshiko Numata, Atsuko Umezawa, Masatoshi Ichihara, Chika Kusano, Yoshiki Murakumo
      Pathology International.2026;[Epub]     CrossRef
    • Advances in the Study of CD109 in Tumors
      平慧 周
      Medical Diagnosis.2024; 14(02): 167.     CrossRef
    • Identification of CD109 in the extracellular vesicles derived from ovarian cancer stem-like cells
      Ye Eun Kim, Jun Se Kim, Min Joo Shin, Seo Yul Lee, Dae Kyoung Kim, Nam-Kyung Lee, Yang Woo Kwon, Kyung-Un Choi, Dong-Soo Suh, Byoung Soo Kim, Sanghwa Jeong, Jae Ho Kim
      BMB Reports.2024; 57(12): 527.     CrossRef
    • CD109 Promotes Drug Resistance in A2780 Ovarian Cancer Cells by Regulating the STAT3-NOTCH1 Signaling Axis
      Jun Se Kim, Min Joo Shin, Seo Yul Lee, Dae Kyoung Kim, Kyung-Un Choi, Dong-Soo Suh, Dayea Kim, Jae Ho Kim
      International Journal of Molecular Sciences.2023; 24(12): 10306.     CrossRef
    • CD109 facilitates progression and 5-fluorouracil resistance of nasopharyngeal carcinoma
      Zhenwei Zhu, Fang Zhou, Cheng Mao
      Materials Express.2022; 12(9): 1189.     CrossRef
    • Usefulness of CD109 expression as a prognostic biomarker in patients with cancer
      Hyun Min Koh, Hyun Ju Lee, Dong Chul Kim
      Medicine.2021; 100(11): e25006.     CrossRef
    • Serum CD109 levels reflect the node metastasis status in head and neck squamous cell carcinoma
      Sumitaka Hagiwara, Eiichi Sasaki, Yasuhisa Hasegawa, Hidenori Suzuki, Daisuke Nishikawa, Shintaro Beppu, Hoshino Terada, Michi Sawabe, Masahide Takahashi, Nobuhiro Hanai
      Cancer Medicine.2021; 10(4): 1335.     CrossRef

    • PubReader PubReader
    • ePub LinkePub Link
    • Cite this Article
      Cite this Article
      export Copy Download
      Close
      Download Citation
      Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

      Format:
      • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
      • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
      Include:
      • Citation for the content below
      Prognostic Significance of CD109 Expression in Patients with Ovarian Epithelial Cancer
      J Pathol Transl Med. 2019;53(4):244-252.   Published online May 2, 2019
      Close
    • XML DownloadXML Download
    Figure
    • 0
    • 1
    • 2
    • 3
    Related articles
    Prognostic Significance of CD109 Expression in Patients with Ovarian Epithelial Cancer
    Image Image Image Image
    Fig. 1. Immunohistochemical staining of CD109 in ovarian epithelial carcinoma. (A) Positive in serous carcinoma. (B) Positive in mucinous carcinoma. (C) Positive in endometrioid carcinoma. (D) Positive in clear cell carcinoma. (E) Positive in undifferentiated carcinoma. (F) Negative in serous carcinoma.
    Fig. 2. Expression of CD109 protein is associated with overall survival. Prognosis is estimated by Kaplan-Meier plots (p=.020).
    Fig. 3. Expression of CD109 protein is not significantly associated with recurrence. Prognosis is estimated by Kaplan-Meier plots (p=.290).
    Fig. 4. Relationship between chemoresistance and CD109 mRNA expression (n=12).
    Prognostic Significance of CD109 Expression in Patients with Ovarian Epithelial Cancer
    No. (%) (n = 120)
    Follow-up, median (range, mo) 50 (1–115)
    Age at diagnosis (yr) 51 (15–82)
     < 50 57 (47.5)
     ≥ 50 63 (52.5)
    Histologic type
     Serous 59 (49.2)
     Mucinous 22 (18.3)
     Endometrioid 9 (7.5)
     Clear cell 27 (22.5)
     Undifferentiated 3 (2.5)
    Histologic grade
     Well differentiated 28 (23.3)
     Moderate differentiated 61 (50.8)
     Poorly differentiated 31 (25.8)
    Nuclear grade
     I 6 (5.0)
     II 65 (54.2)
     III 49 (40.8)
    FIGO stage
     I 51 (42.5)
     II 6 (5)
     III 44 (36.7)
     IV 19 (15.8)
    Mitosis (per 10HPFs)
     1–9 45 (37.5)
     10–19 41 (34.2)
     ≥ 20 34 (28.3)
    Overall survival
     Survival 63 (52.5)
     Death 57 (47.5)
    Recurrence
     Absent 27 (22.5)
     Present 93 (77.5)
    Case No. Histologic type Stage Chemotherapy regimen Period before recurrence (mo) Response
    1 Serous IIIc Carbo-Taxola 4 Poor response
    2 Serous IV Carbo-Taxol 8 Poor response
    3 Serous IIIc Carbo-Taxol 4 Poor response
    4 Serous IIIc Carbo-Taxol 0 Poor response
    5 Serous IV Carbo-Taxol 1 Poor response
    6 Serous IV Carbo-Taxol 0 Poor response
    7 Serous IIIc Carbo-Taxol No recur Good response
    8 Serous IIIc Carbo-Taxol No recur Good response
    9 Serous IIIc Carbo-Taxol No recur Good response
    10 Serous IIa Carbo-Taxol 38 Good response
    11 Serous IIIc Carbo-Taxol No recur Good response
    12 Serous IV Carbo-Taxol 25 Good response
    Gene Sequence (5'-3')
    Cluster of differentiation 109
     Forward GAAGCCATCTCTCAACTTCACA
     Reverse CTCCTTGGAGGCCATGTG
    GAPDH
     Forward GAAGGTGGTGAAGCAGGC
     Reverse TTCCACTGTTAGATCCGCTCC
    Parameter Negative Positive p-valuea
    Histologic type .000
     Serous 13 (22.0) 46 (78.0)
     Mucinous 19 (86.4) 3 (13.6)
     Endometrioid 3 (33.3) 6 (66.7)
     Clear cell 22 (81.5) 5 (18.5)
     Undifferentiated 0 (0) 3 (100)
    Histologic grade .012
     Well differentiated 19 (67.9) 9 (32.1)
     Moderate differentiated 29 (47.5) 32 (52.5)
     Poorly differentiated 9 (29.0) 22 (71.0)
    Nuclear grade .788
     I 3 (50.0) 3 (50.0)
     II 29 (44.6) 36 (55.4)
     III 25 (51.0) 24 (49.0)
    FIGO stage .000
     I 39 (76.5) 12 (23.5)
     II, III and IV 18 (26.1) 51 (73.9)
    Mitoses (per 10HPFs) .000
     1–9 32 (71.1) 13 (28.9)
     ≥ 10 25 (33.3) 50 (66.7)
    Parameter Negative Positive p-valuea
    Histologic grade .351
     Well differentiated 2 (40.0) 3 (60.0)
     Moderate differentiated 9 (24.3) 28 (75.7)
     Poorly differentiated 2 (11.8) 15 (88.2)
    Nuclear grade .850
     I 0 (0) 1 (100)
     II 8 (21.6) 29 (78.4)
     III 5 (23.8) 16 (76.2)
    FIGO stage .004
     I 7 (53.8) 6 (46.2)
     II, III and IV 6 (13.0) 40 (87.0)
    Mitoses (per 10HPFs) .959
     1–9 3 (25.0) 9 (75.0)
     10–19 5 (21.7) 18 (78.3)
     ≥ 20 5 (20.8) 19 (79.2)
    Variable Hazard ratio 95% confidence interval p-value
    Histologic grade
     Well differentiated 1
     Moderate differentiated 0.33 0.12–0.87 .020
     Poorly differentiated 0.63 0.34–1.14 .130
    FIGO stage
     I 1
     II, III, and IV 0.17 0.07–0.38 < .001
    CD109 expression
     Negative 0
     Positive 1.58 0.82–3.05 .160
    Variable Hazard ratio 95% confidence interval p-value
    Histologic grade
     Well differentiated 1
     Moderate differentiated 0.34 0.09–1.26 .220
     Poorly differentiated 0.53 0.21–1.32 .100
    FIGO stage
     I 1
     II, III, and IV 1.29 0.41–0.41 < .001
    CD109 expression
     Negative 1
     Positive 2.06 0.83–5.09 .110
    Parameter CD109 expression
    Negative Positive
    Good response group 7 (33.3) 14 (66.7)
    Poor response group 1 (12.5) 15 (93.8)
    Table 1. Characteristic of the patients

    FIGO, International Federation of Gynecology and Obstetrics; HPF, high-power field.

    Table 2. Fresh tissue samples of ovarian epithelial carcinoma

    Pacilitaxel and carboplatin.

    Table 3. Primer sequences

    GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

    Table 4. Correlation between CD109 expression and clinicopathological characteristics in ovarian epithelial carcinomas (n = 120)

    Negative, less than 10% positive staining of tumor cells; Positive, more than 10% positive staining of tumor cells.

    FIGO, Federation of Gynecology and Obstetrics; HPF, high power field.

    Pearson’s chi-squared test.

    Table 5. Correlation between CD109 expression and clinicopathological characteristics in serous carcinoma (n = 59)

    Values are presented as number (%).

    FIGO, Federation of Gynecology and Obstetrics; HPF, high power field; Negative, less than 10% positive staining of tumor cells; Positive, more than 10% positive staining of tumor cells.

    Pearson’s chi-squared test.

    Table 6. Multivariate analysis of overall survival (n = 120)

    Table 7. Multivariate analysis of recurrence-free survival (n = 120)

    Table 8. Chemotherapy response in correlation with CD109 expression

    Values are presented as number (%).


    J Pathol Transl Med : Journal of Pathology and Translational Medicine
    TOP