1Department of Pathology and Translational Medicine, Seoul National University Bundang Hospital, Seongnam, Korea
2Department of Pathology, Seoul National University College of Medicine, Seoul, Korea
3Artificial Intelligence Institute, Seoul National University, Seoul, Korea
© 2022 The Korean Society of Pathologists/The Korean Society for Cytopathology
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Characteristic | Examined No. | EGFR mutation | p-value |
---|---|---|---|
Total | 2,088 (100) | 1,162 (55.7) | |
Age (yr) | |||
< 40 | 36 (1.7) | 17 (47.2) | .001 |
40–49 | 161 (7.7) | 90 (55.9) | |
50–59 | 427 (20.5) | 277 (64.9) | |
60–69 | 673 (32.2) | 370 (55.0) | |
70–79 | 638 (30.6) | 334 (52.4) | |
≥ 80 | 153 (7.3) | 74 (48.4) | |
Sex | |||
Male | 1,005 (48.1) | 412 (41.0) | < .001 |
Female | 1,083 (51.9) | 750 (69.3) | |
Smoking status | |||
Never | 1,205 (57.7) | 808 (67.1) | < .001 |
Ever | 873 (41.8) | 349 (40.0) | |
Sex and smoking status | |||
Male, never smoker | 216 (10.3) | 120 (55.6) | < .001 |
Male, ever smoker | 786 (37.6) | 291 (37.0) | |
Female, never smoker | 989 (47.4) | 688 (69.6) | |
Female, ever smoker | 87 (4.2) | 58 (66.7) | |
Specimen type | |||
Resection | 1,300 (62.3) | 773 (59.5) | < .001 |
Primary lesion | 1,261 (60.4) | 746 (59.2) | |
Metastatic lesion | 39 (1.9) | 27 (69.2) | |
Biopsy | 776 (37.2) | 385 (49.6) | |
Primary lesion | 463 (22.2) | 241 (52.1) | |
PCNB | 345 (16.5) | 179 (51.9) | |
Bronchoscopic biopsy | 117 (5.6) | 62 (53.0) | |
Thoracoscopic biopsy | 1 (0) | 0 | |
Metastatic lesion | 313 (15.0) | 144 (46.0) | |
PCNB (other than LN) | 52 (2.5) | 29 (55.8) | |
PCNB (LN) | 75 (3.6) | 32 (42.7) | |
EBUS-TBNA biopsy (mediastinal LN) | 154 (7.4) | 64 (41.6) | |
Thoracoscopic biopsy | 29 (1.4) | 18 (62.1) | |
Other biopsies | 3 (0.1) | 1 (33.3) | |
Cytology | 12 (0.6) | 4 (33.3) | |
EBUS-TBNA | 4 (0.2) | 0 | |
Pleural fluid | 8 (0.4) | 4 (50.0) | |
Histologic subtype | |||
Adenocarcinoma in situ | 16 (1.3) | 5 (31.3) | < .001 |
Minimally invasive adenocarcinoma | 145 (11.5) | 92 (63.4) | |
Lepidic adenocarcinoma | 55 (4.4) | 36 (65.5) | |
Acinar adenocarcinoma | 404 (32.0) | 279 (69.1) | |
Papillary adenocarcinoma | 348 (27.6) | 244 (70.1) | |
Micropapillary adenocarcinoma | 52 (4.1) | 37 (71.2) | |
Solid adenocarcinoma | 145 (11.5) | 48 (33.1) | |
Invasive mucinous adenocarcinoma |
91 (7.2) | 5 (5.5) | |
Colloid adenocarcinoma | 2 (0.2) | 0 | |
Enteric-type adenocarcinoma | 3 (0.2) | 0 |
Total occurrence | Positive rate (%) | Relative proportion (%) | Form of mutation, n (%) | ||
---|---|---|---|---|---|
| |||||
Singlet | Compound | ||||
G719X | 49 | 2.3 | 4.2 | 31 (63.3) | 18 (36.7) |
Exon19del | 530 | 25.4 | 45.7 | 521 (98.3) | 9 (1.7) |
T790M |
12 | 0.6 | 1.0 | 3 (25.0) | 9 (75.0) |
S768I | 12 | 0.6 | 1.0 | 3 (25.0) | 9 (75.0) |
Exon20ins | 70 | 3.4 | 6.0 | 64 (91.4) | 6 (8.6) |
L858R | 502 | 24.0 | 43.3 | 487 (97.0) | 15 (3.0) |
L861Q | 19 | 0.9 | 1.6 | 15 (78.9) | 4 (21.1) |
Case | Sex | Age (yr) | PANA results | NGS results | PANA-NGS samples | Sample type (PANA vs. NGS) | TKI treatment | Best response (TTD, mo) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
| |||||||||||
Exon | Nucleotide change | Amino acid change | VAF (%) | ||||||||
N01 | M | 55 | Not identified | 18 18 |
c.2126A > C c.2154_2155delGGinsTT |
p.E709A p.G719C |
32.1 31.0 |
Same | Lung, PCNB | Afatinib | SD (32) |
N02 | M | 55 | Not identified | 18 | c.2127_2129delAAC | p.E709_T710delinsD | 68.5 | Different | Lung, lobectomy (different block) | Afatinib | SD (15) |
N03 | M | 54 | Not identified | 18 20 |
c.2155G > C c.2303_2304delGCinsTT |
p.G719R p.S768I |
27.5 33.7 |
Same | Lung, PCNB | Erlotinib Afatinib Osimertinib |
PR (11) SD (7) PD (ND, 2) |
N04 | M | 68 | Not identified | 19 | c.2214_2231dupTAAAATTCCCGTCGCTAT | p.I744_K745insKIPVAI | 33.7 | Different | Lung, lobectomy (different block) | Erlotinib | SD (24) |
N05 | F | 34 | Not identified | 19 | c.2239_2253delTTAAGAGAAGCAACAinsAAC | p.L747_T751delinsN | 47.8 | Different | Lung, lobectomy (different block) | Erlotinib | PR (NR, 24+) |
N06 | F | 50 | Not identified | 19 26 |
c.2253_2276delATCTCCGAAAGCCAACAAGGAAATinsTTCCGC c.3143C > T |
p.P753_I759delinsA p.A1048V |
10.8 50.0 |
Same | LN, PCNB | Erlotinib | PR (4) |
N07 | F | 59 | Not identified | 20 | c.2284-5_2290dupTCCAGGAAGCCT | p.A763_Y764insFQEA | 20.2 | Same | LN, PCNB | Amivantamab | SD (NR, 9+) |
N08 | M | 67 | Not identified | 20 26 |
c.2303_2305delGCGinsTCT c.3143C > T |
p.S768_V769 > IL p.A1048V |
51.7 60.7 |
Same | Lung, PCNB | Erlotinib |
PR (22) |
N09 | F | 71 | Not identified | 20 | c.2311_2319dupAACCCCCAC | p.N771_H773dup | 13.0 | Same | Lung, PCNB | Not done | - |
N10 | M | 54 | Not identified | 21 | c.2573_2574delTGinsGC | p.L858R | 16.5 | Different | Peritoneum, excision (different lesion) | Not done | - |
N11 | F | 75 | Not identified | 4 | c.500T > C | p.I167T | 3.8 | Same | Lung, PCNB | Not done | - |
N12 | M | 68 | Not identified | 11 | c.1282G > A | p.G428S | 2.3 | Same | Lung, PCNB | Not done | - |
N13 | M | 55 | Not identified | 26 | c.3143C > T | p.A1048V | 44.0 | Different | LN, EBUS-TBNA Bx (different node) | Not done | - |
N14 | F | 49 | Not identified | 26 | c.3143C > T | p.A1048V | 49.9 | Same | Lung, PCNB | Not done | - |
N15 | F | 58 | G719X | 18 18 |
c.2125G > A c.2156G > C |
p.E709K p.G719A |
42.2 41.0 |
Same | LN, PCNB | Erlotinib Afatinib |
SD (6) N/A (ND, 4) |
N16 | F | 36 | Exon19del | 18 19 |
c.2170G > A c.2237_2255delAATTAAGAGAAGCAACATCinsT |
p.G724S p.E746_S752delinsV |
9.8 32.7 |
Same | Pleura, VATS biopsy | Gefitinib Erlotinib |
SD (12.5) SD (9) |
N17 | M | 66 | Exon19del | 17 | c.1996C > T | p.L666F | 45.9 | Same | Lung, PCNB | Erlotinib | SD (ND, 2) |
N18 | F | 50 | Exon19del | Not identified | Different | LN, EBUS-TBNA Bx vs. pleural fluid | Erlotinib Erlotinib |
PD (1) PD (1) |
Values are presented as number (%). EGFR, epidermal growth factor receptor; PCNB, percutaneous needle biopsy; LN, lymph node; EBUS-TBNA, endobronchial ultrasound-transbronchial needle aspiration. Smoking status missing from 10 patients; For primary resection specimens only; Including 11 mixed invasive mucinous and non-mucinous adenocarcinomas (2/11).
EGFR, epidermal growth factor receptor. Excluding acquired T790M mutations.
EGFR, epidermal growth factor receptor; NGS, next-generation sequencing; PANA, PANAMutyper; VAF, variant allele frequency; TKI, tyrosine kinase inhibitor; TTD, time-to-treatment discontinuation; M, male; F, female; PCNB, percutaneous needle biopsy; SD, stable disease; PR, partial response; PD, progressive disease; ND, not detected; NR, not reached; LN, lymph node; EBUS-TBNA, endobronchial ultrasound-transbronchial needle aspiration; Bx, biopsy; N/A, not available; VATS, video-assisted thoracoscopic surgery. Treatment done before NGS test.